1 Required Item TaqMan-QSY M4169 20k PMOL TaqMan-QSY M4169 20k PMOLM4169: 5'-[FAM] TTCTCTAGCAGTGGGACAGCCTGC[QSY]-3' , OLIGO ID: NTH7ARWQty: 1 TaqMan-QSY M4169 20k PMOLM4169: 5'-[FAM] TTCTCTAGCAGTGGGACAGCCTGC[QSY]-3' , OLIGO ID: NTH7ARWQty: 1 17554 - Laboratory Supplies: Asbestos Squares, Corks, Files, Glass Cutters, Ring Stands, Stopcock Grease, Tongs, Wire Gauze, etc. 1.00 Each 2 Required Item Shipping and Handling Shipping and Handling to deliver item to the following address:Auburn TBS Lab located 890 Simms RoadAuburn, AL 36832Point of Contact: Dr. EhsanContact Phone Number: 334-328-6510 Shipping and Handling to deliver item to the following address:Auburn TBS Lab located 890 Simms RoadAuburn, AL 36832Point of Contact: Dr. EhsanContact Phone Number: 334-328-6510 96286 - Transportation of Goods, Shipping and Handling, and Other Freight Services 1.00 Each 3 Required Item M4100 200 nmole desalted M4100 200 nmole desaltedAGTGATGTGCTCGGACCTTCQty: 1 M4100 200 nmole desaltedAGTGATGTGCTCGGACCTTCQty: 1 17554 - Laboratory Supplies: Asbestos Squares, Corks, Files, Glass Cutters, Ring Stands, Stopcock Grease, Tongs, Wire Gauze, etc. 1.00 Each 4 Required Item M4220 200 nmole desalted M4220 200 nmole desaltedCCTGAGGAGAGGCATTTGCTAQty: 1 M4220 200 nmole desaltedCCTGAGGAGAGGCATTTGCTAQty: 1 17554 - Laboratory Supplies: Asbestos Squares, Corks, Files, Glass Cutters, Ring Stands, Stopcock Grease, Tongs, Wire Gauze, etc. 1.00 Each 5 Required Item CONN F 200 nmole desalted CONN F 200 nmole desaltedATGCRGTAGTTAATACTTCQty: 1 CONN F 200 nmole desaltedATGCRGTAGTTAATACTTCQty: 1 17554 - Laboratory Supplies: Asbestos Squares, Corks, Files, Glass Cutters, Ring Stands, Stopcock Grease, Tongs, Wire Gauze, etc. 1.00 Each
